Välj din bakgrundsbild: Välj din bakgrundsbild: Registrera dig för att spara ditt val Stäng
Forum Affär Donate
Huntington's Disease Youth Organization

Huntingtongenen: I mikroskopet

HDYO har mer information om HD för ungdomar, föräldrar och yrkesverksamma på vår webbplats:

www.hdyo.org

Huntingtons sjukdom orsakas av en mutation av en specifik gen i människans DNA. Den här artikeln undersöker denna gen och granskar denna mutation. Vi kommer också att använda oss av familjeträd för att visa hur genen ärvs och förs vidare.

Gener, kromosomer och DNA

DNA, chromosomes and genes

Först ska vi gå igenom grunderna, och vi börjar med DNA. DNA är namnet på den molekyl som utgör våra gener. Bokstäverna ”DNA” står för Deoxyribonucleic Acid (deoxiribonukleinsyra). Fyndigt, inte sant? Och förvånansvärt nog är det nästan ingen som använder dess fulla namn – DNA är mycket lättare att säga och komma ihåg.

DNA-molekylen ärver vi från våra föräldrar och de har ärvt sitt DNA från sina föräldrar och så vidare. Vårt DNA bestämmer vilka vi är, hur vi ser ut och hur vi växer. Saker som vår hårfärg, ögonfärg, längd, om man är man eller kvinna och delar av vår personlighet bestäms av vårt DNA.

DNA är namnet på själva molekylen, men gener är instruktionersom är lagrade in vårt DNA. Vi har många gener – omkring 23000 gener för att vara exakt finns i vår kropps celler. Varje gen är en uppsättning av instruktioner – som ett recept. En gen talar om för cellen hur den ska tillverka en molekyl som kallas protein. Proteiner är maskinerna som utför alla de viktiga uppgifterna i våra celler, från att möjliggöra kemiska reaktioner till att föra vidare meddelanden från en cell till en annan.

Gener sitter ihop som korvar och förpackade i saker som kallas kromosomer. Det finns totalt 46 kromosomer. 23 kommer från ena föräldern och 23 kommer från den andra. Varje cell i våra kroppar innehåller kopior av alla 46 kromosomerna.

Genetisk förändring: Huntingtongenen

Nu när vi har gått igenom grunderna, ska vi titta på huntingtongenen. Ibland sker förändringar (kallas ’mutationer’, av forskare) i kromosomer eller gener. Dessa förändringar kan ändra det sätt som kroppen fungerar och orsaka genetiska störningar. Även en liten förändring i en gen kan orsaka en dramatisk förändring i ett protein. Tänk dig ett recept som talar om för kocken att grädda en paj i 400 minuter istället för 40, så förstår du hur små skrivfel i våra gener kan orsaka stora problem.

År 1993, upptäckte ett gäng forskare genen som orsakar Huntingtons sjukdom på kromosom 4. De upptäckte att en del av genen repeterade sig själv om och om igen, en liknande upprepning som när du håller en tangent nere för länge på ett taaaaaaaaaaaaaaaaaaaaaaaangentbord. Denna repetition är orsaken till utvecklandet av Huntingtons sjukdom och kallas ”CAG repetition”.

Vad är en “CAG repetition”?

CAG repeats

Om du undrar varför upprepningen i huntingtongenen kallas CAG repetition, ja, ungefär som med ’DNA’, är det en förkortning av en mängd komplicerade vetenskapliga ord. DNA är uppbyggt av fyra baser, som är adenine (förkortat A), cytosin ( C ), guanin ( G ) och tymin ( T ). Dessa baser är koderna bakom allt vårt DNA och våra gener. Varje gen har olika koder och, ja, forskare är lata och vill inte skriva ut alla dessa komplicerade ord hela tiden så de använder de korta versionerna. De fyra DNA-baserna kallas A,C,G och T , och om någon skulle skriva ut genkoden skulle det bli ungefär så här: AAGTCCTGACTGGGACCTTGAGA CCTAG.

Om en gen är som ett recept, är baserna ett alfabet av bokstäver som utgör instruktionerna i receptet. Gener använder ett väldigt enkelt alfabet med fyra bokstäver att välja mellan. Men stavningen är väldigt viktig.

Genen som orsakar Huntingtons sjukdom innehåller ett avsnitt där baserna C, A och G upprepar sig många gånger – en CAG repetition. De flesta kopior av genen innehåller mellan 10 och 20 repetitioner, men ibland blir repetitionerna längre och det är då den börjar orsaka problem.

CAG repetitioner

Alla människor har två kopior av Huntingtongenen, oavsett om de riskerar att få Huntingtons sjukdom eller inte. En kopia ärvs från var och en av föräldrarna och varje Huntingtongen innehåller CAG repetitioner.

Det som orsakar att sjukdomen bryter ut är antalet CAG repetitioner. Det är enkelt, personer som utvecklar Huntingtons sjukdom har fler CAG repetitioner än de personer som inte utvecklar sjukdomen. För att göra det enklare att hänga med, ska vi dela upp antalet CAG repetitioner i fyra olika delar. Bara en av kopiorna behöver vara förlängd för att orsaka problem.

26 och lägre (Opåverkat interval)

Som vi nämnde tidigare, har alla människor en serie av CAG repetitioner i Huntingtongenen (även de familjer som inte drabbats av Huntingtons sjukdom). De flesta personer som inte har Huntingtons sjukdom har omkring 10-20 CAG repetitioner. I själva verket är allt upp till 26 CAG repetitioner bra och kommer inte att orsaka några problem. Men, när du kommer över det, kan det förekomma komplikationer.

40 repetitioner och högre (Sjukdomsintervall)

Någon med 40 CAG repetitioner eller högre kommer dessvärre utan tvekan att utveckla Huntingtons sjukdom under sin livstid, med en 50% risk att föra vidare denna gen till sina barn. De flesta personer med Huntingtons sjukdom har mellan 40 och 50 CAG repetitioner.

Att någon har ett antal repetitioner mellan 27 och 39 är ganska ovanligt. Där är det lite svårare att förstå, och i själva verket förstår inte heller forskarna fullt ut, därför kallas det ibland för ”gråzonen”.

27-35 CAG repetitioner (risk för kommande generationer)

Den goda nyheten med ett antal repetitioner mellan 27 och 35 är att personen själv inte kommer att utveckla Huntingtons sjukdom. Däremot, så finns en liten risk (omkring 5%) att personens barn får Huntingtons sjukdom. Det beror på att antalet repetitioner i detta intervall kan öka när de förs vidare till ett barn, till ett antal repetitioner som gör att barnet kan utveckla Huntingtons sjukdom.

36-39 CAG repetitioner (reducerad penetrans)

För människor med repetitioner inom detta spann går det inte att säga om de kommer utveckla Huntingtons sjukdom eller inte. Personer med 36-39 repetitioner kan utveckla symptom av sjukdomen vid en högre ålder; ibland så sent i livet att de kan avlida av hög ålder innan symtomen börjar. Däremot är risken att föra sjukdomen vidare till barn fortfarande 50 %. Forskare kallar denna oförutsägbarhet för ”reducerad penetrans”.

Att ärva den muterade genen för Huntingtons sjukdom

Kärnpunkten: Om Huntingtongenen har för många CAG-repetitioner så orsakar det Huntingtons sjukdom. Nu ska vi förklara hur människor ärver den förlängda genen och hur Huntingtons sjukdom kan föras vidare i familjer.

50 % risk

50% risk

Människor får Huntingtons sjukdom genom att ärva den förlängda genen från en förälder. Eftersom vi ärver en kopia av varje kromosom från vardera förälder, har vi två kopior av varje gen - en från mamma och en från pappa.

Så en person med Huntingtons sjukdom har två kopior av Huntingtongenen, varav en muterad (med många CAG repetitioner) och en normal.

En person utan Huntingtons sjukdom har också två kopior av Huntingtongenen, men båda är normala.

Ett barn med en förälder som har Huntingtons sjukdom har en normal gen från den friska föräldern och kan ha ärvt antingen den muterade genen eller den normala från föräldern med Huntingtons sjukdom.

Detta gör att risken att ha ärvt den muterade genen är 50 %.

Tekniskt sett finns det fyra möjliga utfall vad gäller genernas kombinationer (som bilden visar). Två av dessa utfall medför att barnet ärver den muterade genen och de andra två gör inte det, alltså är risken 50 procent. Men för att göra det lättare att förstå kan du utesluta den förälder som inte har Huntingtons sjukdom och bara fokusera på om barnet ärver den muterade genen eller den normala från föräldern som har Huntingtons sjukdom. Hursomhelst är det fortfarande 50% risk.

Om en person ärver den muterade eller den normala genen beror helt på slumpen. Det är därför du kan höra människor jämföra risken att få Huntingtons sjukdom med att singla slant. Varje individ har alltså 50% risk, så det är som att alla har sin egna slant att singla vad gäller deras egen risk.

25 % sannolikhet

25% grandchild risk

För vissa är dock risken inte alltid så enkel som 50%. Till exempel om ett barns morfar har Huntingtons sjukdom, men barnets förälder inte har testats, så har barnet en 25 % sannolikhet för att ärva den muterade genen.

Det beror på att vi inte vet om föräldern har den muterade genen eller inte. Om föräldern skulle ha den muterade genen, så är risken att barnet har den 50%.

Om föräldern inte har den muterade genen sjunker risken från 25% till 0%, vilket betyder att det inte finns någon risk alls för barnet. Allt handlar om vilka gener föräldern ärvt. Vet man inte det, så är risken 25% att barnet ärvt den muterade genen.

Dominant anlag

Om en person har en muterad gen och en normal gen, hur kommer det sig då att det är den muterade genen som tar kontroll och orsakar Huntingtons sjukdom? Varför slår inte den normala genen tillbaka? Svaret hittar vi i begreppet “dominant anlag”. Huntingtons sjukdom är olyckligtvis vad som kallas en “autosomal dominant sjukdom”, vilket innebär att även om endast en kopia av de två generna är muterad, så kommer det fortfarande att vara tillräckligt för att orsaka sjukdomen. Med andra ord dominerar den muterade genen över den andra normala. Det är därför det bara krävs en muterad gen för att orsaka sjukdomen.

Sammantaget har detta avsnitt förklarat att den gen som orsakar Huntingtons sjukdom är förlängd eftersom den har för många CAG-repetitioner i sig och att dessa CAG-repetitioner är uppdelade i fyra områden. Vi har tittat på risken att ärva Huntingtons sjukdom och hur det fungerar. Trots vissa komplicerade termer så har vi förhoppningsvis förtydligat mer än förvirrat. Om du trots allt har frågor så får ni gärna använda er av STÄLL EN FRÅGA-sektionen, där experter kommer att ge utmärkta svar, alternativt kan du KONTAKTA HDYO direkt om du vill ställa en fråga privat.